Protocols: Single-stranded donor design

Designing an ssODN template for HR-mediated repair

 

 

5’— ~60-nt 5’ homology-attP sequence-NNNNGG ~60-nt 3' homology — 3’’

  • PAM
  • NNN corresponds to the 3-nt adjacent to the PAM site that remain following Cas9 cleavage.
  • attP sequence (50-nt): GTAGTGCCCCAACTGGGGTAACCTTTGAGTTCTCTCAGTTGGGGGCGTAG 

Single-stranded oligonucleotides (ssODNs) of up to 200-nt can be ordered from Integrated DNA Technologies and other companies. Do not have the oligonucleotide PAGE-purified, as this can introduce trace chemical contaminants that reduce embryo viability.

 

Download a PDF of this protocol